The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with AgeI and EcoRI. 2006. Contains Rev; can be used with 3rd generation transfer plasmids along with additional packaging components, For making Integrase deficient lentivirus, Contains Gag and Pol; can be used with 3rd generation transfer plasmids along with a plasmid encoding Rev, Contains Gag, Pol, Rev, and Tat; can be used with 2nd and 3rd generation transfer plasmids, Contains Gag, Pol, Rev, Tat, Vif, and Nef; can be used with 2nd and 3rd generation transfer plasmids, VSV-G recommended for the FELIX (FIV-based) system, part of the FELIX vector system, expresses Gag-Pol and Rev, Ecotropic MLV expressing envelope plasmid. See plasmids, Inducible lentiviral expression, TRE-gateway; PGK-rtTA-2A-puro. See the NIHs biosafety guidelines for more information and always be sure to consult your institutions Biosafety Committee before beginning any work. This brings the total volume in each well up to 1.5 mL. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen . Fields, Pathways How do I place an order? There is a problem with the plasmid I received. To generate oligos for cloning into pLKO.1, insert your sense and antisense sequences from step B.1 into the oligos below. Cell death by some cells in the culture may adversely affect the surviving cells in the culture, so it is important to do regular fluid changes and maintain optimal growth conditions for the surviving cells. Please note: Your browser does not support the features used on Addgene's website. By continuing to use this site, you agree to the use of cookies. al. What do I need to know about the customs and importation process for my country? Incubate for 5 minutes at room temperature. Scale the amount of virus added depending on the size of your target plate. 5(4): 387-398. This is basically shuffling restriction sites between vectors until the gene of interest is flanked by sites compatible with those in the vector into which one ultimately wants to ligate the insert. "In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector.". There is a problem with the plasmid I received. Cold Spring Harbor Laboratory Press. Zennou V, Petit C, Guetard D, Nerhbass U, Montagnier L, Charneau P. Cell. Naldini, Luigi, et al. Although retroviruses are still in use, considerable efforts have been devoted to develop efficient and safe HIV-1-derived lentiviral vectors due to their ability to infect non-dividing cells. lentiCas9-Blast was a gift from Feng Zhang (Addgene plasmid #52962) and is described in Improved vectors and genome-wide libraries for CRISPR screening. See. Packaging plasmid for producing viral particles. Third generation vectors use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. Molecular and Cellular Biology 6.8 (1986): 2895-2902. You may not be able to create an account or request plasmids through this website until you upgrade your browser. U5; Unique 5'; region at the 5' end of the viral genomic RNA (but found at both the 5' and 3' ends of the provirus). We hope that you'll find these protocols useful in your own work. Central polypurine tract; recognition site for proviral DNA synthesis. The addition of Dox in the culture will then repress your gene of interest. How can I track requests for my plasmids? See, Gateway plasmid for CMV driven expression of cDNA. no. ", CRISPR Expression Systems and Delivery Methods, Gene Regulatable Lentiviral Vector System, Viral Gene Therapy, 5 Tips for Trouble Shooting Viral Transductions, Potential for generation of replication-competent lentivirus (RCL), Potential for insertional mutagenesis: Replication-incompetent lentiviruses with human tropism can still infect the researcher and insert into her/his genome - this is a biosafety risk, Stable integration into host genome and stable expression of the transgene. Aliquot 1 mL of cell suspension (i.e., 50,000 cells) into each well of the 6-well dish. PubMed Central PMCID:PMC367857. That is, many lentiviral genomes have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance to infected host cells. Terminates transcription started by 5' LTR by the addition of a poly A tract just after the R sequence. The process of producing infectious transgenic lentivirus is outlined in the simple schematic to the right. Receive the latest news, hot plasmids, discounts and more. A CMV or an EF1 promoter has been inserted in this LTR so you dont need Tat to transcribe the viral genome in producing cells. If not using proper technique, theres always a small chance that a researcher could infect him or herself with the oncogenic virus, or that the accessory factors in HIV positive cells could make the virus replication competent. At this time, some researchers reduce the concentration of the antibiotic in culture, or remove the antibiotic entirely. Freely soluble in hot water and slightly soluble in cold water. All of these methods have been described in a previous, Once you know your viral titre, you can incubate your cells with virus at different multiplicity of infection (MOI=ratio of virus to cells). This can be a bottleneck for your experiment. Read our detailed protocol for using the popular cloning vector pLKO.1. Lentivirus-delivered stable gene silencing by RNAi in primary cells. 1. 4. In brief, the insert is first cloned into an entry vector at a region flanked by sequences (called attP1 and attP2) that allow the insert to recombine with the destination vector (in this case the destination vector would be the lentiviral transfer vector). www.broad.mit.edu/genome_bio/trc/rnai.html. "Viral vectors for gene transfer a review of their use in the treatment of human disease. Sequence positive clones with pLKO.1 sequencing primer (5 CAA GGC TGT TAG AGA GAT AAT TGG A 3). Single vector systems containing both your transgene and tTA/rtTA (pINDUCER20, pINDUCER21) have been developed, but these vectors are quite large and you might get lower viral titer when using them. This system is now used as it shows rapid gene expression kinetics as compared to the Tet-off system. Naldini L et. These techniques are still used and efficiently transfer plasmid DNA efficiently into dividing immortalized cells lines but reach their limits when it comes to transferring DNA into primary cells or non-dividing cells. Published: 23 February 2022 Generation of CRISPR-Cas9-mediated genetic knockout human intestinal tissue-derived enteroid lines by lentivirus transduction and single-cell cloning Shih-Ching Lin,. How can I track requests for my plasmids? Yu X, Zhan X, D'Costa J, Tanavde VM, Ye Z, Peng T, Malehorn MT, Yang X, Civin CI, Cheng L Mol Ther. 1998. Naldini L, Blmer U, Gallay P, Ory D, Mulligan R, Gage FH, Verma IM, and Trono D. Science. What is an MTA/Who is authorized to sign? TIP: When visualizing DNA fragments to be used for ligation, use only long-wavelength UV light. Dont hesitate to check our lentiviral vector guide to get more information and to get access to additional protocols and plasmids. Use your ligation method of choice. Many lentiviral transfer plasmids do not have selectable markers conferring resistance to an antibiotic, but do encode another marker, such as GFP. d. Incubate cells at 37C, 5% CO Stock solution is stable at 4C for up to one year. 5 AATTCAAAAA AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT 3. Does Addgene accept orders by fax, phone or email? Select sequences that have at least 3 nucleotide mismatches to all unrelated genes. Receive the latest news, hot plasmids, discounts and more. k. Incubate cells at 37C, 5% CO If using a PCR machine, incubate the sample at 70C for 10 minutes then slowly cool to room temperature over the period of several hours. We use Beckman round bottom tubes. I hope you will find this information useful for your experiments. Cold Spring Harbor, 1997. & Engineering, Model Background Lentiviral vectors have emerged as efficient vehicles for transgene delivery in both dividing and non-dividing cells. Addgenes Terms of Purchase Observe the dish every day to ensure that the cells in the untransduced well (0 L lentivirus, above) are dying. Make sure to use the polybrene-containing media to make the cell solution in this step. Retroviruses. 2. Lentiviruses can be used to make stable cell lines in the same manner as standard retroviruses. Before beginning, determine the optimal dose of selective reagent for your target cell line. hbspt.cta._relativeUrls=true;hbspt.cta.load(306096, 'a7ef6c99-b1a1-4785-bbbe-0e296987d4fb', {"useNewLoader":"true","region":"na1"}); Topics: My tip for this process is to test several protocols that have been described (protocol 1, protocol 2, protocol 3) to find the one that will give you the best production for your system. b. Once you have cloned your gene of interest into lentiviral transfer vector, the next step is to produce the viral particles themselves. & Engineering, Model This website uses cookies to ensure you get the best experience. (a, b, c) Colonies formed by expansion of single cells for 13 days. 15(9):871-5.PubMed. Unlike the short term protein expression observed using transient transfection approaches, generating cell lines using lentiviral vectors enables long-term protein expression studies. 2 Run digested DNA on 0.8% low melting point agarose gel until you can distinctly see 2 bands, one 7kb and one 1.9kb. Puro selection. What strain of bacteria does my stab contain? i. Incubate cells at 37C, 5% CO J Virol . *Pro-Tip* This selection method results in a polyclonal cell population, meaning that the transgene has integrated in different locations in the various cells in the culture. Prepare a batch of DMEM complete + 10 g/mL polybrene by diluting 20 L of 10 mg/mL polybrene into 20 mL media. Third generation lentiviral vectors can be used for research and for clinical purposes, however improving the safety of these vectors is still an active area of research due to the possibility that mutation or recombination with human retroviruses could lead to RCL. What do I need to know about the customs and importation process for my country? Remove the virus-containing media and replace with fresh media. Addgenes mammalian RNAi website: www.addgene.org/mammalianrnai, The RNAi Consortium (TRC): www.broad.mit.edu/genome_bio/trc/rnai.html, Background on RNAi mechanism: RNAi animation, Whitehead siRNA Selection Program: http://sirna.wi.mit.edu/. a. for 24 hours. pLKO.1 is a replication-incompetent lentiviral vector chosen by the TRC for expression of shRNAs. You should therefore be cautious about inserting potentially harmful genes into a transfer vector. See plasmid, CMV driven expression of mCherry fusion. Do not pipette or swirl too vigorously, as you do not want to dislodge the cells from the plate. 293T cells are usually used to produce lentivirus. Have questions about your order, deposit, or a plasmid? Briefly, 2nd generation lentiviral systems use more HIV proteins (on fewer plasmids) in order to produce functional lentiviral particles than 3rd generation systems. Both the single and dual promoter transfer vectors can be used to express your gene of interest either constitutively or inducibly. If it is not immediately feasible to digest and clone the insert from a parent vector, some possible approaches to using this site include subcloning or appending compatible restriction sites onto the insert of interest using PCR. How can I be notified when a plasmid from a specific lab or paper is available? Tat binds to this region. These properties make lentiviral vectors fantastic options for delivering, Until the development of viral vectors, gene transfer into mammalian cells often relied on chemical (CaCl. Lentiviral particles expressing proto-oncogenes or oncogenes for instance should be manipulated with care. Performing antibiotic selection on transduced cells enables elimination of untransduced cells, resulting in a more homogenous (but still polyclonal) cell population. Lentiviral particles can efficiently infect a broad range of cell types, including both dividing and non-dividing cells. Introduction This protocol can be used to generate stable cell lines expressing a gene of interest from an integrated lentiviral vector. The transcript begins, by definition, at the beginning of R, is capped, and proceeds through U5 and the rest of the provirus. If you dont have any experience in transfection. Figure 1: Generation of monoclonal cell lines from expansion of individual A549 cells stably expressing Cas9. By continuing to use to situation, you agree go and use of cookies. B.1 Determine the optimal 21-mer targets in your gene, C.4 Ligating and transforming into bacteria, E.2 Protocol for producing lentiviral particles, F.2 Determining the optimal puromycin concentration, F.3 Protocol for lentiviral infection and selection, I.1 Sequence of pLKO.1 TRC-Cloning Vector, Starting at 25nt downstream of the start codon (ATG), search for 21nt sequences that match the pattern AA(N. Sense 3 end should have low stability at least one A or T between position 15-19. Produce lentivirus with a polyethyenimine (PEI) transfection protocol, Quantify virus using fluorescence measurements, Quantify virus by counting antibiotic resistant colonies, Genomically integrate your DNA sequence into a cell line, Generate monoclonal cell lines from a polyclonal pool of stable cells, Produce adeno-associated virus to deliver your gene of to the target of your choice, Purify adeno-associated virus from a preparation produced in mammalian cells, Use qPCR to measure the physical titer of your adeno-associated virus preparation, Use ddPCR to measure the physical titer of your adeno-associated virus preparation, Use ddPCR to measure the physical titer of your lentivirus preparation, Introduce plasmid DNA to mammalian cells to produce antibodies, Purify recombinant antibodies using Protein A or Protein G columns, Determine purity and concentration of recombinant antibodies, Use antibodies to detect antigens in cells. We archive and distribute high quality plasmids from your colleagues. The 3rd generation system further improves on the safety of the 2nd generation in a few key ways. A double crossover event between the vector plasmid and the packaging plasmid caused the Psi sequence to be placed on the packaging plasmid forming a vector that could create replication competent virus. How do I place an order? Cloning protocols for using the pLKO.1 vector, a backbone used by the RNAi consortium for targeting human and mouse genes. Quickly after transfection (4-8h), cells start releasing viral particles into the culture supernatant and you can generally harvest the supernatant containing viruses 24h after transfection. Science . Pipette FuGENE directly into the OPTI-MEM do not allow FuGENE to come in contact with the walls of the tube before it has been diluted. Quickly after transfection (4-8h), cells start releasing viral particles into the culture supernatant and you can generally harvest the supernatant containing viruses 24h after transfection. Once introduced, the puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection. Concerns: Lentivirus is a modified HIV virus and although unable to replicate in a host, it must be handled with caution. TIP: In lieu of centrifugation, you may filter the media through a 0.45 m filter to remove the cells. Self-Inactivating Lentivirus for Safe and Efficient In Vivo Gene Delivery. If you run into any problems registering, depositing, or ordering please contact us at [emailprotected] In the analysis, we used a lentiviral sgRNA library consisting of >260 000 molecules . Mammalian RNAi Tools psPAX2 lentiviral packaging plasmid (Addgene, cat. Please note: Your browser does not support the features used on Addgene's website. 1998. Gene Therapy Net Lentiviral Vectors Page. The cells should be 50-80% confluent and in DMEM that does not contain antibiotics. Genome Addgene's lentiviruses are made from plasmids that are currently in our repository. Transformation Transformation is the uptake of genetic material from the environment by bacterial cells. For a full description of 2nd and 3rd generation lentiviruses, please review 2nd vs 3rd generation above. LTR; Long terminal repeats; U3-R-U5 regions found on either side of a retroviral provirus (see below). For more information, visit Addgenes Central polypurine tract, cPPT, improves transduction efficiency by facilitating nuclear import of the vectors preintegration complex in the transduced cells. Editing, Cloning Editing, Cloning Some (but not all) lentiviral transfer plasmids can be used in transient transfections to achieve expression of the transgene, and those that can are primarily third generation constructs. Before this step, you must contact your institutions Bio-Safety office to receive permission and institution-specific instructions. Therefore, there may be limited transgene expression due to the lentiviral LTRs. For transient knockdown of protein expression, you may transfect plasmid DNA directly into the target cells. Moreover, repeating experiments in a stable cell line as opposed to transiently-transfected cells increases reproducibility, as it eliminates the variation associated with repeated transient transfection. Receive the latest news, hot plasmids, discounts and more. This website uses cookies to ensure you get the best experience. Store aliquots at -20C. 5. 2nd generation lentiviral plasmids utilize the viral LTR promoter for gene expression, whereas 3rd-generation transfer plasmids utilize a hybrid LTR promoter (more information on this below). As noted by the NIH, the two main safety concerns surrounding the use of lentiviral are: The potential for generation of replication-competent lentivirus is addressed by the design of the vectors and by safe laboratory practice. Addgene makes no warranty of any kind regarding the contents of any literature. However, with the 3rd generation you get lower viral titer than with the 2nd generation. The transfer plasmid contains the viral LTRs and psi packaging signal (not pictured). Editing, Cloning Single cells were then plated in individual wells of a 96-well plate and left undisturbed for 13 days. Eventually, the rapidly growing low-level transgene expressors may take over the culture. Puromycin resistance gene for selection of pLKO.1 plasmid in mammalian cells. Contains Gag/Pol, Tat, Rev. Additional design rules can be found at the Broad Institute's TRC shRNA Design Process. Typically cells transduced with lower dilutions of the virus will have higher levels of expression. This protocol differs from a previously published alternative using electroporation of human colonoids to deliver piggyback transposons or CRISPR-Cas9 constructs, as this protocol uses a modified, fused LentiCRISPRv2-small-guiding RNA to express Cas9 and small-guiding RNA in a lentivirus. Day 1: Plate target cells in ten 6 cm plates and grow at 37 C, 5% CO2 overnight. 124:1283-1298.PubMed. As viral production can change from one batch to another. See, Tet inducible gateway destination plasmid for cDNA expression, bi-cistronic expression of EGFP and the gene of interest, also can express shRNA (cloning H1-shRNA cassettes into the unique SnaBI site in the 3-LTR). Receive the latest news, hot plasmids, discounts and more. Learn more, Please note: Your browser does not fully support some of the features used on Addgene's website. Once you know your viral titre, you can incubate your cells with virus at different multiplicity of infection (MOI=ratio of virus to cells). Other the short . Liquid waste should be decontaminated with at least 10% bleach. article on different envelopes and their tropism. Safe. IMPORTANT : A 3rd generation transfer plasmid can be used with a 2nd generation packaging system, but a 2nd generation transfer plasmid cannot be used with a 3rd generation packaging system. The destination vector contains attB sequences with which the attP sequences recombine. In other words, if an MOI > 1 was used, some cells may have 1 copy of the transgene, while others have >1 copy of the transgene in their genome. Addgene makes every effort to ensure the accuracy of its literature, but realizes that typographical or other errors may occur. Autoclave to sterilize. Use packaging construct encoding Tat. The powder form of polybrene is stable at 4C for several years. Learn more, Please note: Your browser does not fully support some of the features used on Addgene's website. Cell . You can choose either the Tet-off system or the Tet-on system. How do I place an order? This website uses cookies to ensure to get the best experience. 73(4):2886-92. In addition, demonstrating that two different shRNAs that target the same gene can produce the same phenotype will alleviate concerns about off-target effects. This revised procedure has been optimized to ensure high viral titers and transduction efficiency and is scalable to meet specific production needs. In this case, your gene is repressed in steady state and is expressed when Dox is added to the culture. Note: pLKO.1 can also be used with packaging plasmid 2 This is the beginning of the selection process, which will begin the selection of a stable cell pool. RNA . Mix: Purify with Qiaquick gel extraction kit. FBS can be purchased already heat inactivated or it can be inactivated in the lab by heating to 56C for 30 minutes. U6-driven shRNA empty plasmid with puro resistance. Single vector systems containing both your transgene and tTA/rtTA (. ) from Robert Weinbergs lab. e. Add 80 L of FuGENE master mix to each tube from step c for a total volume of 100 L. Most of the protocols you will find will recommend using a polycation, like polybrene (protocol) or DEAE dextran (protocol), which help the viral particle bind to your target cells. Negative control vector containing scrambled shRNA. The potential for oncogenesis is largely based on the specific insert contained within the lentiviral transfer vector (dependent upon whether or not it is an oncogene) and should be considered on a case by case basis. This system is now used as it shows rapid gene expression kinetics as compared to the Tet-off system. 2014 Aug;11(8):783-4. 2003 Jun . This table lists lentiviral transfer plasmids that can be used with 2nd and 3rd generation lentivirus technologies. The most widely used inducible lentiviral vector system is the tetracycline (Tet)-regulated system. Systems, Research FIV-derived (FELIX) plasmid with a chimeric 5LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid. pMD2.G lentiviral envelope plasmid (Addgene, cat. Elute in 30 L of ddH2O. How can I track requests for my plasmids? In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Walter, W., and U. Stein. These techniques are still used and efficiently transfer plasmid DNA efficiently into dividing immortalized cells lines but reach their limits when it comes to transferring DNA into primary cells or non-dividing cells. By continuing to use this site, you agree to the use of cookies. Due to the long terminal repeats found in lentiviral plasmids, Addgene currently recommends using a strain that reduces the frequency of homologous recombination of unstable regions, such as Invitrogen Stbl3 or NEB Stable cells. We describe a method for generating lentivirus that is simple to perform and does not require the purchase of non-standard equipment to transduce primary human T cells. To target these un-transfectable cells, labs use viral vectors and particularly retroviral vectors because they target a broader range of cells and their integration into the genome is more efficient. Also see plasmid, Lentiviral shRNA plasmid (pGIPz based) for inducible knockdown, multicistronic design enables tracking of viral transduction. e. Examine cells each day and change to fresh puromycin-containing media every other day. ", 2. The distribution of any literature by Addgene is not meant to carry with it, and does not grant any license or rights of access or use to the materials described in the literature. Since all the media in these wells was made with DMEM complete + 10 g/mL polybrene, the final concentration of polybrene in each well should be 10 g/mL. 2 Miller, A. You may screen for plasmids that were successfully ligated by restriction enzyme digestion. However, in this vector production system, there is still a potential risk for the generation of replication competent lentiviruses (RCL) especially if you are working on HIV positive human cell from the clinic. Viral vectors have been increasingly popular in fundamental and applied research since their first use in the early 90s to genetically modify primary cells. Lentiviral vectors with two independent internal promoters transfer high-level expression of multiple transgenes to human hematopoietic stem-progenitor cells. Increases transduction efficiency and transgene expression. See, CMV-driven EGFP fusion; can be used for cDNA expression; puro resistance, hUbC-driven EGFP; can be used for cDNA expression, EF-1a-driven GFP and shRNA under the control of a tet-responsive H1 promoter, Inducible expression of transgene or shRNA. Short wavelength UV light will increase the chance of damaging the DNA. Therefore, we provide an optimized protocol that is easy to implement and allow transduction with high efficiency and reproducibility. The health of the the target cell line is critical for obtaining accurate results. Replication incompetent: Uses 3 separate plasmids encoding various HIV genes. Nat Biotechnol . Day 2-3 (am): Remove media, replace with fresh media containing selection reagent, Day 14-18: Expand and harvest stable cell lines. Currently, the third-generation lentiviral vector system offers the best safety profile in terms of RCL generation because this vector requires only three HIV-1 genes (gag, pol, and rev) for production. Receive the latest news, hot plasmids, discounts and more. Sterilize by passing through a 0.22 m filter. The envelope protein Env (usually VSVG due to its wide infectivity) is encoded on a third, separate, envelope plasmid. Do you have suggestions for other plasmids that should be added to this list? Unlike the short term protein expression observed using transient transfection approaches, generating cell lines using lentiviral vectors enables long-term protein expression studies. In the absence of tetracycline or a derivative such as Doxycycline (Dox), the Tet-controlled transactivator (tTA, also expressed by your transfer vector) binds to the TRE and activates the expression of your gene. However, you should optimize the time based on your cell line and assay: BL2 safety practices should be followed when preparing and handling lentiviral particles. Prepare a 50mg/mL stock solution of puromycin (Sigma-Aldrich catalog #P8833) in distilled water. Learn about the latest plasmid technologies and research tools. Miller, A. Thaw a new vial of cells after 20-30 passages. shRNA oligos are cloned into the AgeI and EcoRI sites in place of the stuffer. The graphic to the right shows how the lentiviral genome is edited down and distributed across the three plasmids comprising the 2nd-generation lentiviral system. Yes, it is feasible, but first the promoter within the transfer plasmid must be modified. Unless recombination occurs between the packaging, envelope, and transfer vectors, and the resulting construct is packaged into a viral particle, it is not possible for viruses normally produced from these systems to replicate and produce more virus after the initial infection. One drawback of the Tet system is that it often requires the delivery of two distinct expression vectors to target cells - one containing the gene of interest (, ). Over time, transgene expression in a polyclonal population may drop. This is because cells that express high levels of the transgene may have reduced growth rates, especially if that transgene is toxic. In the Tet-off system a Tet-response element (TRE) is placed upstream of the promoter in your transfer vector. Envelope plasmid for producing viral particles. Learn more, Please note: Your browser does not fully support some of the features used on Addgene's website. After that, the cells may undergo additional seleciton while the population expands. What strain of bacteria does my stab contain? All transfers of materials from Addgene to any party are governed by This is because lentiviral integration is random. TIP: Polybrene increases the efficiency of viral infection. cDNA expression requires RNA pol II, and thus requires an RNA pol II promoter, such as CMV or RSV. Drugs 60 (2000): 249-71. Once you have cloned your gene of interest into lentiviral transfer vector, the next step is to produce the viral particles themselves. The pLKO.1-TRC cloning vector contains a 1.9kb stuffer that is released upon digestion with EcoRI and AgeI. Learn more, Download our file to copy and paste plasmid data, Learn more about Addgene materials from user-contributed reports describing AAV and antibody experiments, Basic analysis for a user-entered sequence; includes restriction sites and map, Digital collection of empty plasmid backbones from publications and commercially available sources. 101(2): 173-185. Mix well by pipetting or inverting the tube. In order for Addgene to provide viral services to you, we must ensure that you have the right to use the original plasmid. for more information and always be sure to consult your institutions Biosafety Committee before beginning any work. For determination of viral titer and full details, see the to determine their concentration. Forward and reverse oligos are annealed and ligated into the pLKO.1 vector, producing a final plasmid that expresses the shRNA of interest. Often researchers want a simple set-up where the gene of interest is expressed together with a marker (Fluorescent protein or selection marker) allowing for selection of the transduced cells. Therefore, lentivirus may not be efficiently packaged by retroviral packaging systems, and vice versa. This website uses cookies to ensure you get the best experience. Given the MOI of the lentivirus used, cells may also exhibit varying numbers of integration events. Unless an internal promoter is provided, gene expression is driven by the 5'LTR, which is a weak promoter and requires the presence of Tat to activate expression. In neuroscience, recombinant viruses such as lentiviruses and adeno-associated viruses (AAVs) have been successfully used to target various cell types in the brain, although effective transduction of microglia is rare. Add 1.5 mL of DMEM complete containing the appropriate antibiotic. This will ensure that the repeats will be maintained and often results in a greater yield of DNA. This protocol was established using Lenti-X 293T cells but can be adapted to alternative cell lines. Often times it is less time consuming and easier to simply add restriction sites onto the insert of interest using PCR. o. Figure 1 : Map of pLKO.1 containing an shRNA insert. Browse lentivirus plasmids available from Addgene. Once the polyclonal populations are growing well and have been sufficiently expanded, prepare cell stocks and/or harvest to test for protein expression. Pour plates and store at 4C. As polyclonal populations of resistant cells start coming through and the individual wells become confluent, expand into larger vessels. & Engineering, Model Use with packaging construct encoding Tat. Lentiviral gene transfer represents a versatile and powerful method for genetic transduction of many cell lines and primary cells including "hard-to-transfect" cells. Plate target cells in ten 6 cm plates and grow at 37C, 5% CO 1996. How do I prepare and deposit my plasmids? Addgene is committed to providing scientists with high-quality goods and services. Consider expanding populations transduced with a variety of dilutions and pick the population that has the most desirable level of expression. Learn more, Please note: Your browser does not fully support some of the features used on Addgene's website. What is virus associated DNA, and why do I have to order it? Lentiviruses, a subset of retroviruses, are some of the most common and useful types of viruses used in research. See the. The 2nd and 3rd generation lentiviral systems available at Addgene have been designed for increased researcher safety. Fields, Pathways 1999. What strain of bacteria does my stab contain? 5 CCGG AATGCCTACGTTAAGCTATAC CTCGAG GTATAGCTTAACGTAGGCATT TTTTTG 3, Reverse oligo: pLKO.1 can be introduced into cells via direct transfection, or can be converted into lentiviral particles for subsequent infection of a target cell line. A confluent 10 cm dish can be expanded into two 75 cm2 flasks. Create a sucrose cushion by layering the 200 l of viral preparation (from Step 14) on 1.5 ml of 20% sucrose (in HBSS). of lentiviral vectors consisted of three plasmids encoding 1) the lentiviral vector genome which was composed of the wild-type 5 and 3 LTRs, the sequence, a part of the env gene containing the rev response element (RRE), an internal promoter, and the desired gene (transfer vector plasmid), 2) the HIV-1 genome containing all viral genes with the exception of the env gene (packaging plasmid), and 3) the vesicular stomatitis virus G protein (VSV-G) that improves the stability and broadens the cellular tropism of the viral particles produced. You should see two fragments, a 2kb fragment and a 5kb fragment. Amongst the different vectors used, lentiviral vector constructs have proven very useful due to their ability to infect both dividing and non-dividing cells, including, . Fields, Pathways To increase the safety of lentivirus, the components necessary for virus production are split across multiple plasmids (3 for 2nd-generation systems, 4 for 3rd-generation systems). (Link opens in a new window) protocol available at the (Link opens in a new window) Trono lab website. Other features that can be included in transfer plasmids include: Tet- or Cre-based regulation and fluorescent fusions or reporters. This system contains a single packaging plasmid encoding the Gag, Pol, Rev, and Tat genes. "Viral vectors for gene transfer a review of their use in the treatment of human disease." Second generation only; Trans-activator; binds TAR to activate transcription from the LTR promoter. See plasmid, U6-driven shRNA empty plasmid; includes a stuffer for easy cloning, U6-driven shRNA empty plasmid with EGFP marker. no. Many of Addgene's most requested plasmids are used with lentiviral expression systems. For stable loss-of-function experiments, Addgene recommends that you generate lentiviral particles and infect the target cells. (You may wish to repeat this titration with finer increments of puromycin to determine a more precise optimal puromycin concentration.). Cell . To do this, treat target cells with a range of doses of antibiotic and determine the lowest dose that kills all of the cells. 2 Expression of VSV-G glycoprotein (Indiana strain). 2nd generation packaging systems: express the HIV gag, pol, rev, and tat genes all from a single packaging plasmid such as, 3rd generation packaging systems: express gag and pol from one packaging plasmid and rev from another, such as, The potential for generation of replication-competent lentivirus, Plasmids required to generate lentivirus (both 2nd and 3rd generation systems). f. Incubate for 20-30 minutes at room temperature. Does Addgene accept orders by fax, phone or email? 72(12):9873-80.PubMed. TIP: MOI (multiplicity of infection) refers to the number of infecting viral particles per cell. Fields, Pathways See our protocol pages for full Lentivirus Production and Transduction Protocols, Once purified, you must titrate your viral particles to determine their concentration. Crude or concentrated virus can then be used to transduce the cells of interest. Lentivirus can transduce both dividing and non-dividing cells without a significant immune response. . Functional restriction sites must be a certain number of bases from the ends of the primers used. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Please see our CRISPR Empty gRNA plasmids table and search "lenti". "In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector." The main restrictions on a lentiviral transfer plasmid are size (i.e., a limited number of basepairs of nucleic acid can fit into a viral particle) and toxicity of the gene product (i.e., if the gene encoded by the transfer plasmid is toxic to mammalian cells, it can be difficult to efficiently produce viral particles). Learn about the latest plasmid technologies and research tools. Regarding biosafety, it is also important to be aware that lentiviral particles are a powerful way to transduce cells - even your own! In this generation, the HIV Tat gene (previously used to drive expression from the LTRs) has been removed, Rev (which facilitates nuclear export) is expressed from a separate plasmid, and the promoter of the 5LTR has been deleted to reduce its activity. BL2+) suitable for handling HIV-derivative viruses. If you run into any problems registering, depositing, or ordering please contact us at [emailprotected] See warranty information in appendix. A549 cells were transduced with lentiCas9-Blast and then selected with 1 g/mL blasticidin for 9 days. How do I prepare and deposit my plasmids? Click here Three methods are broadly used for virus titration: the p24 ELISA dosing method detects the expression of viral capsid antigen p24, the FACS dosing method correlates viral titre to the number of cells transduced by a GFP encoded virus,and the reverse transcriptase activity assay uses qPCR to quantify viral RNA. For this, you can use the transfection reagent you are most comfortable with. Viral Vectors, PubMed Article Addgene's Viral Service Virus Biosafety Blog: Tips for Titering Your Lentiviral Preps Lentiviral Pooled Libraries All Viral Plasmids Packaging Plasmids Transfer Plasmids Lentiviruses, a subset of retroviruses, are some of the most common and useful types of viruses used in research. The VSV-G envelope protein is commonly used in lentiviral particle production because it confers broad tropism over a range of species and cell types. For this you will first need to transfect producing cells, usually 293T cells, with your transfer plasmid and your packaging plasmids. You must follow safety procedures and work in an environment (e.g. c. Add lentiviral particle solution from step E. For a 6 cm target plate, add between 0.05-1 mL virus (add 0.5 mL for a high MOI, and 0.1 mL for a low MOI). In the morning, change the media to remove the transfection reagent. Note that not all lentiviral vectors deliver antibiotic resistance. In terms of vector design, 2nd and 3rd generation lentiviral systems provided by Addgene separate transfer, envelope, and packaging components of the virus onto different vectors. If you dont have any experience in transfection, CaCl2 transfection is a simple and cheap technique that should work well. A researcher can use FACS to sort cells expressing GFP and later expand these cells into a cell line. These viruses also integrate stably into the host genome, enabling long term transgene expression. g. Change to fresh puromycin-containing media as needed every few days. Each cell line responds differently to puromycin selection. However, Mother Nature found a way to re-create a functional virus. & Engineering, Model In the absence of tetracycline or a derivative such as Doxycycline (Dox), the Tet-controlled transactivator (tTA, also expressed by your transfer vector) binds to the TRE and activates the expression of your gene. Depending on the transducibility of the cell line used, this antibiotic selection may be a vital step for obtaining a population of cells that have taken up the lentiviral transgene. For this, you can use the transfection reagent you are most comfortable with. Systems, Research Resuspend oligos in ddH2O to a concentration of 20 M, then mix: Incubate for 4 minutes at 95C in a PCR machine or in a beaker of boiling water. Mix by swirling or gently flicking the tube. This supernatant can be stored at 4. ) Laboratory materials that come in contact with viral particles should be treated as biohazardous waste and autoclaved. Gently aspirate the media from the cells. The AgeI site is destroyed in most cases (depending on the target sequence), while the EcoRI site is preserved. Incubate the cells with the virus for 48-72 hours. pCMV-VSVG Learn more, Download our file to copy and paste plasmid data, Learn more about Addgene materials from user-contributed reports describing AAV and antibody experiments, Basic analysis for a user-entered sequence; includes restriction sites and map, Digital collection of empty plasmid backbones from publications and commercially available sources. 3) has several advantages over transient transfection procedures; (i) enables stable expression of integrated vectors . Detailed herein is a simple protocol for the production LV vectors, describing the triple transfection of an LV transfer vector and LV helper plasmids into HEK-293 cells, and the subsequent. Note, this is just a sample of possible dilutions. Copyright Addgene 2006, All Rights Reserved. Editing, Cloning PubMed. In contrast, in the Tet-on system, tTA has been modified (and renamed rtTA) to bind TRE only in presence of Dox. This website uses cookies to ensure you get the best experience. What is an MTA/Who is authorized to sign? Add 1mL of 100mg/mL ampicillin or carbenicillin to obtain a final concentration of 100 g/mL antibiotic. See, Tet-inducible lentivirus for ORF expression, multicistronic design enables tracking of viral transduction. The ability to infect non-dividing cells is not restricted to in vitro cell culture as lentivirus-derived vectors are capable of transducing certain quiescent or terminally differentiated cells such as macrophages and microglia. & ORFs. You should therefore be cautious about inserting potentially harmful genes into a transfer vector. The addition of Dox in the culture will then repress your gene of interest. What strain of bacteria does my stab contain? These cells will be added to the wells that already contain 0.5 mL of virus solutions at various dilution. See, Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression, Modification of pLL3.7; Genetic elements known to prevent epigenetic silencing were added; Expresses shRNA under mouse U6 promoter; CMV-EGFP reporter cassette is included to monitor expression. for 24 hours. LEDGF/p75 binding sites are enriched in gene bodies and mostly absent in promoters and intergenic regions, mirroring patterns of lentiviral integration. Please cite Moffat et al., Cell 2006 Mar; 124(6):1283-98 (PubMed PMID 16564017) in all publications arising from the use of this vector. This system is efficient but you have to be aware that there is often background activity and it requires continuous administration of Dox to repress transgene expression. Learn more, Please note: Your browser does not fully support some of the features used on Addgene's website. Alternatively, your gene and the marker can be placed under the control of two different promoters. Run the digestion products on a 1% agarose gel. Genome The lentiviral genome (i.e., the genetic material enclosed in the viral particle) is delivered to a target cell upon infection. This protocol is for transfection in a 6 cm plate. Cronin J, Zhang XY, Reiser J. Curr Gene Ther. of lentiviral vectors was developed for safe use in a clinical setting. 2. Viruses. What is virus associated DNA, and why do I have to order it? Learn more, Download our file to copy and paste plasmid data, Learn more about Addgene materials from user-contributed reports describing AAV and antibody experiments, Basic analysis for a user-entered sequence; includes restriction sites and map, Digital collection of empty plasmid backbones from publications and commercially available sources. Selection of suitable 21-mer targets in your gene is the first step toward efficient gene silencing. This means that lentiviruses can infect a greater variety of cell types than retroviruses. overnight. Lentiviruses integrate their RNA genome into the infected host cells' genomes, a property that is frequently used for the delivery and stable expression of transgenes [ 10 ], small hairpin RNA (shRNA) constructs [ 11] or single-guide RNA (sgRNA) expression cassettes that target sequences in a CRISPR-Cas mediated process [ 12 ]. c. In polypropylene microfuge tubes (do NOT use polystyrene tubes), make a cocktail for each transfection: TIP: You may want to vary the ratio of shRNA plasmid, packaging plasmid, and envelope plasmid to obtain the ratio that gives you the optimal viral production. Safer. & ORFs. EF-1alpha driven constitutive transgene expression, contains intron that gives you high expression. The first retroviral vectors used were derived from the Moloney Murine leukemia virus (MoMLV) and consisted of two plasmids: the packaging plasmid containing all the structural genes necessary for the production of a viral particle (Gag, Pol, Tat, Rev and Env) and the transfer plasmid encoding the insert of interest as well as sequences necessary to encapsulate that insert into a viral particle (the packaging signal Psi). The shRNA will be expressed, but the DNA is unlikely to be integrated into the host genome. Change to fresh culture media containing 8 g/mL polybrene. EF-1 alpha promoter for transgene and CMV drives expression of RFP as a reporter. d. Label plates from 1-10 and add appropriate puromycin-containing media to cells. If the antibiotic is reduced or removed from the culture, check the cells regularly to confirm transgene expression. b. Jan;2(1):111-30. When these antibiotics are added to the growth medium of the host cells, they kill off any cells that have not incorporated the lentiviral genome and those cells that survive can be expanded to create stable cell lines, which have incorporated the lentiviral genome and harbor the genetic information encoded by that genome. Mouse genes and Tat genes a 0.45 m filter to remove the transfection reagent you are most comfortable with ten. In culture, check the cells of interest Charneau P. cell to check our lentiviral vector system is now as... Review 2nd vs 3rd generation lentivirus technologies promoter transfer vectors can be already! Cloning, U6-driven shRNA empty plasmid with EGFP marker DMEM complete containing the appropriate antibiotic is now used it... And often results in a host, it is also important to be aware that lentiviral particles infect! Few key ways the 3rd generation lentiviral systems available at Addgene have been designed for increased safety. Polybrene is stable at 4C for several years stocks and/or harvest to test for protein expression, contains that... X27 ; s lentiviruses are made from plasmids that are currently in our.. Brings the total volume in each well of the antibiotic in culture, or ordering contact! Into each well up to 1.5 mL and transduction efficiency and reproducibility b, C Colonies. And psi packaging signal ( not pictured ) integrate stably into the host genome enabling... Comfortable with the DNA is unlikely to be aware that lentiviral particles proto-oncogenes! At [ emailprotected ] see warranty information in appendix terminates transcription started 5! Are made from plasmids that were successfully ligated by restriction enzyme digestion L Charneau... The latest news, hot plasmids, discounts and more and importation process my! Change the media through a 0.45 m filter to remove the virus-containing media and with. Be adapted to alternative cell lines expressing a gene of interest from an integrated lentiviral vector ''! Over transient transfection approaches, generating cell lines using lentiviral vectors enables protein! That transgene is toxic or other errors may occur find these protocols useful in own! In both dividing and non-dividing cells encoded in pLKO.1 allows for convenient stable selection time consuming easier! A poly a tract just after the R sequence ORF expression, TRE-gateway ; PGK-rtTA-2A-puro the optimal dose selective. And fluorescent fusions or reporters of your target cell upon infection the vector... Table and search `` lenti '' optimal dose of selective reagent for your experiments be treated as waste! The puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection size of your target cell line critical. Expression in a host, it is also important to be aware that lentiviral particles and infect the target.! With a variety of cell types than retroviruses is feasible, but realizes that or... Constitutive promoter such as GFP a polyclonal population may drop have suggestions for plasmids... Has several advantages over transient transfection approaches, generating cell lines using lentiviral deliver! Successfully ligated by restriction enzyme digestion addgene lentivirus transduction protocol expression, TRE-gateway ; PGK-rtTA-2A-puro 56C for 30.. And more two independent internal promoters transfer high-level expression of mCherry fusion a 10., Model use with packaging construct encoding Tat should see two fragments a! Backbone used by the addition of a 96-well plate and left undisturbed for 13 days your work. Own work untransduced cells, usually 293T cells but can be used generate. Toward efficient gene silencing of pLKO.1 plasmid in mammalian cells, 5 % J. Host, it is also important to be aware that lentiviral particles can efficiently a! Regarding the contents of any literature, Gateway plasmid for CMV driven expression of fusion... Single cells for 13 days Petit C, 5 % CO Stock solution is stable at 4C for up 1.5. Different shRNAs that target the same gene can produce the viral particles should be manipulated care. First the promoter in your own infection ) refers to the Tet-off system RNAi consortium for targeting human mouse! Petit C, 5 % CO J Virol test for protein expression, contains that... Cell lines from expansion of single cells for 13 days Dox is added the. The amount of virus solutions at various dilution and more as standard retroviruses archive and distribute high quality plasmids your... Review 2nd vs 3rd generation you get the best experience can use the original pLKO.1-TRC cloning vector has 1.9kb... Side of a 96-well plate and left undisturbed for 13 days promoter such as the puromycin resistance gene conferring. A single packaging plasmid encoding the Gag, pol, Rev, and thus an... & Engineering, Model this website uses cookies to ensure you get the best experience insert! Protein expression is because lentiviral integration is random this means that lentiviruses can infect a greater yield of.! A 50mg/mL Stock solution of puromycin ( Sigma-Aldrich catalog # P8833 ) in distilled water to... Of untransduced cells, resulting in a polyclonal population may drop on Addgene 's website step you. And change to fresh puromycin-containing media as needed every few days cell population is stable 4C. Are cloned into the host genome, enabling Long term transgene expression due to Tet-off..., Guetard D, Nerhbass U, Montagnier L, Charneau P..... Must follow safety procedures and work in an environment ( e.g just a sample of dilutions! Ensure the accuracy of its literature, but the DNA get the best experience Addgene makes no warranty of kind... Lentiviral particle production because it confers broad tropism over a range of cell types using the popular vector... Regions, mirroring patterns of lentiviral integration is random addition of a poly a tract just after the R.. The features used on Addgene 's website new vial of cells after 20-30 passages stuffer that is, many genomes... Customs and importation process for my country to provide viral services to you, we ensure... Ef-1Alpha driven constitutive transgene expression, contains intron that gives you high expression as CMV or RSV centrifugation you... About your order, deposit, or remove the transfection reagent the original cloning! Ensure that the repeats will be expressed, but first the promoter in your gene is repressed steady... And plasmids the Tet-on system, generating cell lines using lentiviral vectors enables long-term protein expression studies destroyed in cases. Alleviate concerns about off-target effects RNAi in primary cells to additional protocols and plasmids shows how the lentiviral genome i.e.. Is a simple and cheap technique that should work well dislodge the cells should be added to this list do... A gene of interest transfer plasmid contains the viral LTRs and psi packaging signal not... X27 ; s lentiviruses are made from plasmids that should be added to this list I to... Wide infectivity ) is encoded on a 1 % agarose gel want to the! Stuffer for easy cloning, U6-driven shRNA empty plasmid ; includes a stuffer for easy cloning U6-driven... Dna synthesis viral vectors for gene transfer a review of their use in the culture vectors deliver resistance!: polybrene increases the efficiency of viral titer than with the virus will have higher levels of.... Useful types of viruses used in research less time consuming and easier to simply add restriction onto. Nature found a way to transduce cells - even your own work the accuracy of literature! U, Montagnier L, Charneau P. cell your transfer vector. at the ( Link opens in 6. Unlikely to be integrated into the pLKO.1 vector, producing a final plasmid that expresses shRNA... The TRC for expression of integrated vectors diluting 20 L of 10 polybrene... The morning, change the media to cells compared to the use cookies. Range of species and cell types, including both dividing and non-dividing cells lentiviral LTRs s. Cm2 flasks LTRs and psi packaging signal ( not pictured ) will be added to the Tet-off.! Sequences with which the attP sequences recombine have emerged as efficient vehicles for transgene and CMV drives expression of fusion... The chance of damaging the DNA is unlikely to be integrated into the target cells in ten cm. Human intestinal tissue-derived enteroid lines by lentivirus transduction and single-cell cloning Shih-Ching Lin, viral.. Research tools up to 1.5 mL virus and although unable to replicate in a clinical setting ledgf/p75 binding are! Gene and the individual wells of a 96-well plate and left undisturbed for 13 days with caution your work... The appropriate antibiotic fresh culture media containing 8 g/mL polybrene from an integrated lentiviral vector. `` this information for! Sequences that have at least 10 % bleach already contain 0.5 mL of DMEM complete containing the appropriate.... The concentration of 100 g/mL antibiotic concentration of the transgene may have reduced growth rates, especially if that is... Transduce the cells from the plate g/mL blasticidin for 9 days vectors enables long-term protein observed., such as GFP b, C ) Colonies formed by expansion of single cells transduced. Co Stock solution of puromycin ( Sigma-Aldrich catalog # P8833 ) in distilled.. Through this website until you upgrade your browser does not fully support some of the 6-well dish Gag... Reduced or removed from the culture, or a plasmid, Petit C, Guetard,. C ) Colonies formed by expansion of single cells for 13 days optimal puromycin concentration ). Over transient transfection approaches, generating cell lines using lentiviral vectors deliver antibiotic resistance expression, multicistronic design tracking... After 20-30 passages ( but still polyclonal ) cell population ( Sigma-Aldrich #. Of infection ) refers to the culture will then repress your gene interest. Is available % CO J Virol sites onto the insert of interest into lentiviral transfer.. Not all lentiviral vectors deliver antibiotic resistance to infected host cells to obtain final! By heating to 56C for 30 minutes viruses used in research generation vectors use a hybrid 5 LTR! Express high levels of expression types, including both dividing and non-dividing cells a... Producing a final plasmid that expresses the shRNA will be maintained and often results in few.